آنزیم PI-PspI | کمپانی NEB

آنزیم PI-PspI | کمپانی NEBآنزیم PI-PspI | کمپانی NEB
برند:

آنزیم PI-PspI | کمپانی NEB

لطفا جهت مطالعه توضیحات بیشتر این محصول به لینک سایت زیر مراجعه نمایید:

https://www.neb.com/products/r0695-pi-pspi#Product%20Information

PI-PspI (5,000 units/ml) Catalog number: R0695S Size: 500 units

واردات محصول فوق سه هفته الی یک ماه زمان بر خواهد بود

ریال

اکنون موجود نیست؛ اما می‌توانید این محصول را پیش‌خرید کنید

تحویل اکسپرس
پشتیبانی 24 ساعته
پرداخت در محل
7 روز ضمانت بازگشت
ضمانت اصل بودن کالا

توضیحات محصول

آنزیم PI-PspI | کمپانی NEB

آنزیم PI-PspI | کمپانی NEB

مشخصات محصول:

  • This is a homing endonuclease
  • Tolerates some sequence degeneracy within recognition sequence
  • Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)

Size

Concentration

Catalog

500 units 5,000 units/ml R0695S

آنزیم PI-PspI | کمپانی NEB

بررسی تخصصی

آنزیم PI-PspI | کمپانی NEB
سایر ویژگی‌ها
یونیت مورد نظر را انتخاب کنید
500

دیدگاه کاربران

4 دیدگاه برای آنزیم PI-PspI | کمپانی NEB

  1. Preston

    Nice post. I learn someething totally new and challenging oon blogs I stumbleupon onn
    a daipy basis. It’s always interesting to
    read content froom other riters and ppractice a little ssomething from otheer wweb sites.

  2. Ramon

    Thank you, I’ve reccently been looking ffor informayion approxximately this suhject ffor agtes and yours is tthe greatest I’ve discovered so far.
    However, what iin regards to thee conclusion? Arre you positive in retards to the supply?

  3. Tonja

    What i don’t understood is iif truth bbe topd how you are noow not actuakly much more well-preferred than yoou may be ight now.

    You arre soo intelligent. Youu recognize thus onsiderably
    when iit cimes to thos subject, poduced mee in my vuew coonsider iit frm numerouss aried angles.
    Itts like menn aand women aare not involved until iit is one thing to do ith Girl gaga!

    Youur psrsonal stuffs outstanding. At all times deal with
    it up!

  4. Vicki

    I delight in, result in I found judt what I wwas aking a ook for.
    You’ve endded myy four dayy long hunt! Good Blews youu man. Havee a
    great day. Bye

دیدگاه خود را بنویسید

نشانی ایمیل شما منتشر نخواهد شد. بخش‌های موردنیاز علامت‌گذاری شده‌اند *