آنزیم PI-PspI | کمپانی NEB
آنزیم PI-PspI | کمپانی NEB
لطفا جهت مطالعه توضیحات بیشتر این محصول به لینک سایت زیر مراجعه نمایید:
https://www.neb.com/products/r0695-pi-pspi#Product%20Information
PI-PspI (5,000 units/ml) Catalog number: R0695S Size: 500 units
واردات محصول فوق سه هفته الی یک ماه زمان بر خواهد بود
1 ریال
اکنون موجود نیست؛ اما میتوانید این محصول را پیشخرید کنید
توضیحات محصول
آنزیم PI-PspI | کمپانی NEB
مشخصات محصول:
- This is a homing endonuclease
- Tolerates some sequence degeneracy within recognition sequence
- Cut Site: TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17)
Size |
Concentration |
Catalog |
500 units | 5,000 units/ml | R0695S |
آنزیم PI-PspI | کمپانی NEB
بررسی تخصصی
سایر ویژگیها | ||
---|---|---|
|
Preston –
Nice post. I learn someething totally new and challenging oon blogs I stumbleupon onn
a daipy basis. It’s always interesting to
read content froom other riters and ppractice a little ssomething from otheer wweb sites.
Ramon –
Thank you, I’ve reccently been looking ffor informayion approxximately this suhject ffor agtes and yours is tthe greatest I’ve discovered so far.
However, what iin regards to thee conclusion? Arre you positive in retards to the supply?
Tonja –
What i don’t understood is iif truth bbe topd how you are noow not actuakly much more well-preferred than yoou may be ight now.
You arre soo intelligent. Youu recognize thus onsiderably
when iit cimes to thos subject, poduced mee in my vuew coonsider iit frm numerouss aried angles.
Itts like menn aand women aare not involved until iit is one thing to do ith Girl gaga!
Youur psrsonal stuffs outstanding. At all times deal with
it up!
Vicki –
I delight in, result in I found judt what I wwas aking a ook for.
You’ve endded myy four dayy long hunt! Good Blews youu man. Havee a
great day. Bye