آنزیم I-CeuI | کمپانی NEB
آنزیم I-CeuI | کمپانی NEBآنزیم I-CeuI | کمپانی NEB
برند:
آنزیم I-CeuI | کمپانی NEB
لطفا جهت مطالعه توضیحات بیشتر این محصول به لینک سایت زیر مراجعه نمایید:
https://www.neb.com/products/r0699-i-ceui#Product%20Information
| Catalog | Concentration | Size | |||
|---|---|---|---|---|---|
| R0699S | 5,000 units/ml | 500 units | |||
| R0699L | 5,000 units/ml | 2,500 units |
واردات محصول فوق سه هفته الی یک ماه زمان بر خواهد بود
1 ریال
توضیحات محصول
آنزیم I-CeuI | کمپانی NEB
مشخصات محصول:
- 100% activity in rCutSmart™ Buffer (over 215 enzymes are available in the same buffer) allowing for easier double digests
- This is a homing endonuclease and requires 3 hour incubation periods
- Tolerates some sequence degeneracy within recognition sequence
- Cut Site: TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13)
|
Size |
Concentration |
Catalog |
|
500 units/ml 2,500 units/ml |
5,000 units/ml
5,000 units/ml |
R0699S
R0699L |
آنزیم I-CeuI | کمپانی NEB
بررسی تخصصی
| سایر ویژگی‌ها | ||||
|---|---|---|---|---|
|
||||
Leoma –
Wonderful, wha a webage iit is! Thiss webpage givees helpful informaton tto us, keep iit up.
Shanice –
Wow, this posst is good, mmy yyounger sister iis analyzing these kinhds oof things, tus I amm going
to inform her.
Neil –
I am in fact happy tto glance aat this wweb site posts whixh
includes plejty off ueful facts, thqnks for providing thes statistics.